View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20460_high_37 (Length: 208)
Name: NF20460_high_37
Description: NF20460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20460_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 390719 - 390888
Alignment:
| Q |
18 |
gacatggcgatggatgcttggtgtttcaggtgtgcctgcacttatccagttcatttgcatgctcttcctccccgaatctccaagatggctatttataaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
390719 |
gacatggcgatggatgcttggtgtttcaggtgtgcctgcacttatccagttcatttgcatgctcttcctccccgaatctccaagatggctatttataaag |
390818 |
T |
 |
| Q |
118 |
gtacaaatttgctcttctcaacaattgtacatgtcccagatgtacatgtactgcagaagtaacttgtttataat |
191 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
390819 |
gtacaaatttgctcttctcaacaattg----tgtcccagatgtacatgtactgcagaagtaacttgtctataat |
390888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 52771664 - 52771573
Alignment:
| Q |
22 |
tggcgatggatgcttggtgtttcaggtgtgcctgcacttatccagttcatttgcatgctcttcctccccgaatctccaagatggctatttat |
113 |
Q |
| |
|
||||| |||||| | |||||||||| ||| ||||||||| | || |||||| |||||| |||||||| ||||| ||||||||||| ||||| |
|
|
| T |
52771664 |
tggcgttggatgttgggtgtttcagctgtccctgcacttgttcaattcattctcatgcttttcctccctgaatcaccaagatggctttttat |
52771573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 107
Target Start/End: Complemental strand, 52768311 - 52768222
Alignment:
| Q |
18 |
gacatggcgatggatgcttggtgtttcaggtgtgcctgcacttatccagttcatttgcatgctcttcctccccgaatctccaagatggct |
107 |
Q |
| |
|
|||||||||||||||||| || ||||| |||||||| ||| | || ||||| || |||||||||||| || ||||| || |||||||| |
|
|
| T |
52768311 |
gacatggcgatggatgctgggagtttcgggtgtgccagcagtaattcagttttttctcatgctcttcctgcctgaatcgcccagatggct |
52768222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University