View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20460_low_17 (Length: 402)
Name: NF20460_low_17
Description: NF20460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20460_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 82 - 384
Target Start/End: Original strand, 27429096 - 27429406
Alignment:
| Q |
82 |
acatttatgctgaaaagatgatacctcatttcaatgtatcgactcaaataacactttcaaacatttacaacccaaaaag--------agatgctttattt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
27429096 |
acatttatgctgaaaagatgatacctcatttcaatgtatcgactcaaataacactttcaaacattgacaacccaaaaagttaaatagagatgctttattt |
27429195 |
T |
 |
| Q |
174 |
tctctctttatatataaaggtaagtaatcattattcatgaggatcaggagtgtgtggccattgtattttgaatgctgtaaataggatatatctcacaaca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27429196 |
tctctctttatatataaaggtaagtaatcattattcatgaggatcaggagtgtgtggccattgtattttgaatgctgtaaataggatatatctcacaaca |
27429295 |
T |
 |
| Q |
274 |
ttcacaaattaactatctccatcaactttttgcttattgcactaaaccccacattcccactcaccccaaaacaacaaaacctgaaaacctcaccacatta |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27429296 |
ttcacaaattaactatctccatcaactttttgcttattggactaaaccccacattcccactcaccccaaaacaacaaaacctgaaaacctcaccacatta |
27429395 |
T |
 |
| Q |
374 |
atacagacacc |
384 |
Q |
| |
|
||||||||||| |
|
|
| T |
27429396 |
atacagacacc |
27429406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University