View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20460_low_36 (Length: 210)
Name: NF20460_low_36
Description: NF20460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20460_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 191
Target Start/End: Complemental strand, 24543890 - 24543707
Alignment:
| Q |
8 |
ggaggagcagagatagtagttaggggcaaagcagataaacatgtctcgtggaatatatgactgcatggaagaatagcaacttcagataaaacagtactac |
107 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24543890 |
ggaggatcagtgatagtagttaggggcaaagcagataaacatgtctcgtggaatatatgactgcatggaagaatagcaacttcagataaaacagtactac |
24543791 |
T |
|
| Q |
108 |
tcaaatcttctcttccttgggaagagaataaataatgttgtagctcatcttctccatcttgaattgaatcttcctctgcctctt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24543790 |
tcaaatcttctcttccttgggaagagaataaataatgttgtagctcatcttctccatcttgaattgaatcttcctcttcctctt |
24543707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University