View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20460_low_37 (Length: 208)

Name: NF20460_low_37
Description: NF20460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20460_low_37
NF20460_low_37
[»] chr7 (1 HSPs)
chr7 (18-191)||(390719-390888)
[»] chr1 (2 HSPs)
chr1 (22-113)||(52771573-52771664)
chr1 (18-107)||(52768222-52768311)


Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 390719 - 390888
Alignment:
18 gacatggcgatggatgcttggtgtttcaggtgtgcctgcacttatccagttcatttgcatgctcttcctccccgaatctccaagatggctatttataaag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
390719 gacatggcgatggatgcttggtgtttcaggtgtgcctgcacttatccagttcatttgcatgctcttcctccccgaatctccaagatggctatttataaag 390818  T
118 gtacaaatttgctcttctcaacaattgtacatgtcccagatgtacatgtactgcagaagtaacttgtttataat 191  Q
    |||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||| ||||||    
390819 gtacaaatttgctcttctcaacaattg----tgtcccagatgtacatgtactgcagaagtaacttgtctataat 390888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 52771664 - 52771573
Alignment:
22 tggcgatggatgcttggtgtttcaggtgtgcctgcacttatccagttcatttgcatgctcttcctccccgaatctccaagatggctatttat 113  Q
    ||||| |||||| | |||||||||| ||| ||||||||| | || ||||||  |||||| |||||||| ||||| ||||||||||| |||||    
52771664 tggcgttggatgttgggtgtttcagctgtccctgcacttgttcaattcattctcatgcttttcctccctgaatcaccaagatggctttttat 52771573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 107
Target Start/End: Complemental strand, 52768311 - 52768222
Alignment:
18 gacatggcgatggatgcttggtgtttcaggtgtgcctgcacttatccagttcatttgcatgctcttcctccccgaatctccaagatggct 107  Q
    |||||||||||||||||| || ||||| |||||||| ||| | || |||||  ||  |||||||||||| || ||||| || ||||||||    
52768311 gacatggcgatggatgctgggagtttcgggtgtgccagcagtaattcagttttttctcatgctcttcctgcctgaatcgcccagatggct 52768222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University