View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20461_high_7 (Length: 237)
Name: NF20461_high_7
Description: NF20461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20461_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 85 - 221
Target Start/End: Original strand, 28435860 - 28435996
Alignment:
| Q |
85 |
gtcatatttgattatttggtatctcttctctttctttttctttgggtcaagtatctctcataactattttaagtaattaacccaaacaatggaccttgct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28435860 |
gtcatatttgattatttggtatctcttctctttctttttctttgggtcaagtatctctcataaccattttaagtaattaacccaaacaatggaccttgct |
28435959 |
T |
|
| Q |
185 |
tattgacaaaaccgatggctctcgttagcggtgttta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28435960 |
tattgacaaaaccgatggctctcgttagcggtgttta |
28435996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University