View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_high_15 (Length: 379)
Name: NF20463_high_15
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 17 - 367
Target Start/End: Complemental strand, 7777468 - 7777118
Alignment:
| Q |
17 |
ctcctttggtaaggctatattgcactaggtggttgcaaccttcttttatggctgtacaagaaccctcatttgattagtgtgttttggttttaggattaca |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7777468 |
ctccattggtaaggctatattgcactaggtggttgcaaccttcttttatggctgtacaagaaccctcatttgattagtgtgttttggttttaggattaca |
7777369 |
T |
 |
| Q |
117 |
cgattcaacctccaactcaagaacttgttgttcgagatttgcatgataatacatggacatttcgacatatttaccgaggtgaggatgttttctgcatcta |
216 |
Q |
| |
|
| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7777368 |
caattcaacccccaactcaagaacttgttgttcgagatttgcatgataatacatggacatttcgacatatttaccgaggtgaggatgttttctgcatcta |
7777269 |
T |
 |
| Q |
217 |
tgtagcacctagcatatacactttagattaatggtgtgtccggtgtatgatatgtgtgtcagaatcggtcaccgacacatatagttacattcaannnnnn |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7777268 |
tgtagcacctagcatatacactttagattaatggtgtgtccggtgtatgatatgtgtgtcagaatcggtcaccgacacatgtagttacattcaatttttt |
7777169 |
T |
 |
| Q |
317 |
ncacgttttctaattgttgtcagtgtcggtttcatgtgtggtgttcatatc |
367 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7777168 |
tcacgttttctaattattgtcagtgtcggtttcatgtgtggtgttcatatc |
7777118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University