View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_high_17 (Length: 367)
Name: NF20463_high_17
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 18 - 357
Target Start/End: Complemental strand, 438024 - 437682
Alignment:
| Q |
18 |
caaccgttgtgaaaagaacaaggtcgtgattcaactaacgttagatcaaggggtattgaaatttgacctacgagttttgcagtgttgaaaacgcatgaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
438024 |
caaccgttgtgaaaagaacaaggtcgtgattcaactaacgttagatcaaggggtattgaaatttgacctacgagttttgcagtgttgaaaacgcatgaag |
437925 |
T |
 |
| Q |
118 |
ggtttgtgttagttttgaaaacggagattttgatgagagggtttttaaagttagagatttgtgattttgggaaatcaaaggtagcagcgagagagtgagg |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
437924 |
ggtttgtgttcgttttgaaaacggagattttgatgagagggtttttaaagttagagatttgtgattttgggaaatcaaaggtagcagcgagagagtgagg |
437825 |
T |
 |
| Q |
218 |
gtgtgtttctgattcagatattagaggaactgttgcaacgtggcaaggt---ggagaatcaacgcctttgagtttgatttcgcagtagcatgtggagctt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
437824 |
gtgtgtttctgattcagatattagaggaactgttgcaacgtggaaaggtggaggagaatcaacgcctttgagtttgatttcgcagtagcatgtggagctt |
437725 |
T |
 |
| Q |
315 |
gaaggatgaactttgccggagaatgatggttttgatgatgatg |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
437724 |
gaaggatgaactttgccggagaatgatggttttgatgatgatg |
437682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University