View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20463_high_38 (Length: 254)

Name: NF20463_high_38
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20463_high_38
NF20463_high_38
[»] chr5 (1 HSPs)
chr5 (99-253)||(4003698-4003852)


Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 99 - 253
Target Start/End: Complemental strand, 4003852 - 4003698
Alignment:
99 ttagttaaatgcagaaagtattggggaggactttgggaaaaaagaatttgcaaatggaaaaaatatggaggtttgagaggggaaaactttgaaaggttta 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4003852 ttagttaaatgcagaaagtattggggaggactttgggaaaaaagaatttgcaaatggaaaaaatatggaggtttgagaggggaaaactttgaaaggttta 4003753  T
199 attttcttcataactccaaaagaaagccataatggttgccatggatgattattaa 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4003752 attttcttcataactccaaaagaaagccataatggttgccatggatgattattaa 4003698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University