View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_high_45 (Length: 242)
Name: NF20463_high_45
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 10551906 - 10552119
Alignment:
| Q |
18 |
taaaataacaatcatcttctttcaacaagtagcgatggttgattgctctgaaacgcatatcatgttaggtgcaacgacaacagcaagaacgtgatcctgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10551906 |
taaaataacaatcatcttctttcaacaagtagcgatggttgattgctctggaacacatatcatgttaggtgcaacgacaacagcaagaacgtgatcctgt |
10552005 |
T |
 |
| Q |
118 |
caaacacaattacaacgaacagcgtcaactatatgctttctatgcaagacaggagatagattacacaaggatatggtaagaaaatgtcctgaattctctt |
217 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| || |
|
|
| T |
10552006 |
caaacacaatcacaacgaacaccgtcaactatatgttttctatgcaagacaggagatatattacacaaggatatggtaagaacatgtcctaaattctttt |
10552105 |
T |
 |
| Q |
218 |
tttaactcattctt |
231 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
10552106 |
ttcaactcattctt |
10552119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 10569437 - 10569635
Alignment:
| Q |
18 |
taaaataacaatcatcttctttcaacaagtagcgatggttgattgctctgaaacgcatatcatgttaggtgcaacgacaacagcaagaacgtgatcctgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10569437 |
taaaataacaatcatcttctttcaacaagtagcgatggttgattgctctgaaacgcatatcatgttaggtgcaacg---------------tgatcctgt |
10569521 |
T |
 |
| Q |
118 |
caaacacaattacaacgaacagcgtcaactatatgctttctatgcaagacaggagatagattacacaaggatatggtaagaaaatgtcctgaattctctt |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10569522 |
caaacacaatgacaacgaacagcgtcaactatatgttttctatgcaagacaggagatagattacacaaggatatggtaagaacatgtcctgaattctctt |
10569621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University