View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_high_50 (Length: 212)
Name: NF20463_high_50
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_high_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 17 - 156
Target Start/End: Complemental strand, 36865364 - 36865221
Alignment:
| Q |
17 |
caaaggatgccacgtatatccaacctattttggagattactgctgatgaacgtctcaatgttgatg----catctcaagagagaaccatagagaaacatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36865364 |
caaaggatgccacgtatatccaacctattttggagattactgctgatgaacgtctcaatgttgatatatacatctcaagagagaaccatagagaaacatt |
36865265 |
T |
|
| Q |
113 |
tggatttttctcccaaaggagatcaaattacaaattatgatatt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865264 |
tggatttttctcccaaaggagatcaaattacaaattatgatatt |
36865221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 36865188 - 36865152
Alignment:
| Q |
155 |
ttctcaagagtcaagactcttgtaattccaaggtagt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865188 |
ttctcaagagtcaagactcttgtaattccaaggtagt |
36865152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University