View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_high_6 (Length: 606)
Name: NF20463_high_6
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 4e-95; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 4e-95
Query Start/End: Original strand, 22 - 241
Target Start/End: Original strand, 28450773 - 28450992
Alignment:
| Q |
22 |
aggaggggaatttaaagaatggaatgtaaaattccaaaacgtagtttaaataagcttttcgaaactcataaactgt-ggaaaaattagagaagccaaacg |
120 |
Q |
| |
|
||||||||| || |||||||||||| |||||||||||| |||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
28450773 |
aggaggggacttcgaagaatggaatg-aaaattccaaaaagtagtttaaataagcttttcgatacctataaactgtaggaaaaattagagaagccaaacg |
28450871 |
T |
|
| Q |
121 |
tgcgcggggaagagtcttaaaatttgggttgaacctcaagtcgacgaaactagattttaaggtgatgactatttcaagtttgataagtactacctagtag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28450872 |
tgcgcggggaagagtcttaaaatttgggttgaacctcaagtcgacgaaactagattttaaggtgatgactatttcaagtttgataagtactacctagtag |
28450971 |
T |
|
| Q |
221 |
atgcggaacttcaacacacac |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28450972 |
atgcggaacttcaacacacac |
28450992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 247 - 368
Target Start/End: Original strand, 28451033 - 28451153
Alignment:
| Q |
247 |
taaaagggatctcaacatagagaagtgattttggtttatttaatctattctgaagagaattagtaaaaatgtgatatttatactctaaagcctataaatg |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28451033 |
taaaagggatctcaacatagagaagtgattttggtttatttaatctattctgaagagaattagtaaaaatgtgatatttatactct-aagcctataaatg |
28451131 |
T |
|
| Q |
347 |
taattgtcatctataaaacaca |
368 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28451132 |
taattgtcatctataaaacaca |
28451153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 467 - 606
Target Start/End: Original strand, 28451282 - 28451426
Alignment:
| Q |
467 |
aacacaatgaatgcaacggaaa-----tgaaatgacgggatacctgatggaggagcgaaaatttggagatgacgaagtccagtgaaagagggatagagtg |
561 |
Q |
| |
|
|||||||||||||||||||||| |||||||| || |||||||||||||||||||| ||| ||||| ||||||||||||||||||||||| || | |
|
|
| T |
28451282 |
aacacaatgaatgcaacggaaatgaaatgaaatgaaggtatacctgatggaggagcgaagattgggagaggacgaagtccagtgaaagagggaagtaggg |
28451381 |
T |
|
| Q |
562 |
attgggattttggtctataatttcggagtgtagttggagaagaac |
606 |
Q |
| |
|
|||||||||| |||| || |||||||||| ||||||||||||| |
|
|
| T |
28451382 |
attgggatttgactctagaaattcggagtgttgttggagaagaac |
28451426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 405 - 450
Target Start/End: Original strand, 28451194 - 28451239
Alignment:
| Q |
405 |
cttcaaacagtgatacagagtaattaaacaaaaaatgtaaacaata |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28451194 |
cttcaaacagtgatacagagtaattaaacaaaaaatgtaaacaata |
28451239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University