View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_low_22 (Length: 322)
Name: NF20463_low_22
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 32674766 - 32674624
Alignment:
| Q |
17 |
cattgacaactcctgatacaagccatccacaaggaacaccaggaaacaagcacaacaatttgagtgttcttcaacagcactgtgcnnnnnnngatcagga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32674766 |
cattgacaactcctgatacaagccatccacaaggaacaccaggaaacaagcacaacaatttgagtgttcttcaacagcactgtgctttttttgatcagga |
32674667 |
T |
 |
| Q |
117 |
tggaaatggaatcatttacccttgggaaacttacacgggtaag |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32674666 |
tggaaatggaatcatttacccttgggaaacttacacgggtaag |
32674624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 203 - 312
Target Start/End: Complemental strand, 32674580 - 32674471
Alignment:
| Q |
203 |
gaggcttccatgtttcaaagagatgaatgattcttgacctaaagagtttttcagggtttcgtgctcttggatttaatgtgattgtatcagtttttatggc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32674580 |
gaggcttccatgtttcaaagagatgaatgattcttgacctaaagaatttttcagggtttcgtgctcttggatttaatgtgatcgtatcagtttttatggc |
32674481 |
T |
 |
| Q |
303 |
cattttcatc |
312 |
Q |
| |
|
|||||||||| |
|
|
| T |
32674480 |
cattttcatc |
32674471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University