View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_low_25 (Length: 309)
Name: NF20463_low_25
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 11 - 292
Target Start/End: Complemental strand, 7322792 - 7322510
Alignment:
| Q |
11 |
cagagaccaatgtgtaagggatactacctttcaatgaattcagtagaattgactgcctagaattctcagtagaatctagggaggaaagtgttttacaggt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7322792 |
cagagaccaatgtgtaagggatactacctttcaatgaattcagtagaattgactgcctagaattctcagtagaatctagggaggaaagtgttttacaggt |
7322693 |
T |
|
| Q |
111 |
tactgcctagaattggtttagtttatgtgaggcattgcagtgaattttatattgatttcagtcatttaaactttctgtcgcgggatcaactatcttccaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7322692 |
tactgcctagaattggtttagtttatgtgaggcattgcagtgaattttatattgatttcagtcatttaaactttctatcgcgggatcaactatcttccaa |
7322593 |
T |
|
| Q |
211 |
gtaagataattttgaaagcatgtttactttttctatgattctttcgaacgttctgc-cagatgaaattgctcagggaactttg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
7322592 |
gtaagataattttgaaagcatgtttactttttctatgattctttcgaacgttctgcacagatgacattgctcagggaactttg |
7322510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 79 - 159
Target Start/End: Original strand, 7231190 - 7231271
Alignment:
| Q |
79 |
gtagaatctagggaggaaagtgttttacaggttactgcctagaattggtttagtttatgt-gaggcattgcagtgaatttta |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
| T |
7231190 |
gtagaatctagggaggaaagtgttttacaggttactgcctagaattggtttagtttatgtcgaggtataacagtgaatttta |
7231271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 29265011 - 29264973
Alignment:
| Q |
11 |
cagagaccaatgtgtaagggatactacctttcaatgaat |
49 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
29265011 |
cagagaccaatatgtaagggatgctacctttcaatgaat |
29264973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 75 - 133
Target Start/End: Complemental strand, 25615519 - 25615463
Alignment:
| Q |
75 |
ctcagtagaatctagggaggaaagtgttttacaggttactgcctagaattggtttagtt |
133 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||| |||| |||||||| |
|
|
| T |
25615519 |
ctcagtagaatctagggagaaaagtgttt--gaggttactgcctaaaatttgtttagtt |
25615463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University