View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_low_26 (Length: 307)
Name: NF20463_low_26
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 83 - 288
Target Start/End: Original strand, 45583826 - 45584031
Alignment:
| Q |
83 |
cacaacaatgtattgataatgatagattcctctctcaaacagacaaatgggaatttatcactcaaattattatcttactttcatgcatctctctatctct |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45583826 |
cacaacaatgtattgataatgatagattcctctctcaaacagacaaatgggaatttatcactcaaattattatcttactttcatgcatctctctatctct |
45583925 |
T |
 |
| Q |
183 |
gaaaacacatttattaaaactgcatcatatcatgtttcagaatggctgataccttacaatcgttgatggtgatagtatatattcattcaatatagactta |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45583926 |
gaaaacacatttattaaaactgcatcatatcatgtttcagaatggctgataccttacaatcgttgatggtgatagtatatattcattcaatatagactta |
45584025 |
T |
 |
| Q |
283 |
ttcact |
288 |
Q |
| |
|
|||||| |
|
|
| T |
45584026 |
ttcact |
45584031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 45583745 - 45583788
Alignment:
| Q |
10 |
attattctatatgtgcaacttcccttcatctgcacacacatgaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45583745 |
attattctatatgtgcaacttcccttcatctgcacacacatgaa |
45583788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University