View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_low_32 (Length: 288)
Name: NF20463_low_32
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 105 - 259
Target Start/End: Complemental strand, 36172715 - 36172561
Alignment:
| Q |
105 |
caattgagttctgttcttagggttatgcttgcataacaagttccgttcttacggttggaaaaagcattattagcgacatgctgtagtgcagtctataggt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36172715 |
caattgagttctgttcttagggttatgcttgcataacaagttctgttcttacggttggaaaaagcattattagggacatgctgtagtgcagtctataggt |
36172616 |
T |
 |
| Q |
205 |
ttttctgtctctctctctatctatatataaaccacagatagggagagacttgaga |
259 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36172615 |
ttttctgtctttctctctatctatatataaaccacagatagggagagacttgaga |
36172561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 55
Target Start/End: Complemental strand, 36172810 - 36172768
Alignment:
| Q |
13 |
agttgatgttattatatcacttttttgtaaaacttaatttctg |
55 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36172810 |
agttgatgttattacatcacttttttgtaaaacttaatttctg |
36172768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 287
Target Start/End: Complemental strand, 36158689 - 36158625
Alignment:
| Q |
224 |
tctatatataaaccacagatagggagagactt-gagagagacattgtttgtttttattcaatttt |
287 |
Q |
| |
|
||||| |||| | |||||| |||||||||||| |||||||||||| |||||||||||||| |||| |
|
|
| T |
36158689 |
tctatctatagatcacagacagggagagactttgagagagacattctttgtttttattcagtttt |
36158625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University