View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_low_39 (Length: 254)
Name: NF20463_low_39
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 99 - 253
Target Start/End: Complemental strand, 4003852 - 4003698
Alignment:
| Q |
99 |
ttagttaaatgcagaaagtattggggaggactttgggaaaaaagaatttgcaaatggaaaaaatatggaggtttgagaggggaaaactttgaaaggttta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4003852 |
ttagttaaatgcagaaagtattggggaggactttgggaaaaaagaatttgcaaatggaaaaaatatggaggtttgagaggggaaaactttgaaaggttta |
4003753 |
T |
 |
| Q |
199 |
attttcttcataactccaaaagaaagccataatggttgccatggatgattattaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4003752 |
attttcttcataactccaaaagaaagccataatggttgccatggatgattattaa |
4003698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University