View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_low_41 (Length: 252)
Name: NF20463_low_41
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_low_41 |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0102 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 238
Target Start/End: Complemental strand, 25104 - 24878
Alignment:
| Q |
12 |
atcatcactgctaatgctatcttgtttatttctatgaagaggtatgaattcaaagtaagagaatgtgggtacaacagcaaaagtaacttcttctggaggc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
25104 |
atcatcactgctaatgctatcttgtttatttctatgaagaggtatgaattcaaagtaagagaatgtgggtacaacagcaaatgtaacttcttctggtggc |
25005 |
T |
 |
| Q |
112 |
aaactaggattaacattaacaccaatccagctttcagttgaaccataatcagcactaatcaaaggcaacccatttgcataatgtctaagttttttcaaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25004 |
aaactaggattaacattaacaccaatccagctttcagttgaaccataatcagcactaatcaaaggcaacccatttgcataatgtctaagttttttcaaat |
24905 |
T |
 |
| Q |
212 |
aaggttgcattgaacctgtcattattg |
238 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
24904 |
aaggttgcattgaccctgtcattattg |
24878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University