View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_low_42 (Length: 247)
Name: NF20463_low_42
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 46009355 - 46009136
Alignment:
| Q |
6 |
tagtggagtagcataggcaggtccatgtagttgagattatatgcactattttcttcaccacgaggggttgctggaactactgttgaaattcttgaaattt |
105 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009355 |
tagtggagtttcataagcaggtccatgtagttgagattatatgcactattttcttcaccacgaggggttgctggaactactgttgaaattcttgaaattt |
46009256 |
T |
|
| Q |
106 |
ggggaggagtttccaaattaggtagtgaacccatttccggaaagagacaaaagaaggttgtttttgcaatatgaaaagaaagtatagtagttgtttggtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009255 |
ggggaggagtttccaaattaggtagtgaacccatttccggaaagagacaaaagaaggttgtttttgcaatatgaaaagaaagtatagtagttgtttggtt |
46009156 |
T |
|
| Q |
206 |
tcgacgttggatatgttcct |
225 |
Q |
| |
|
||||||| ||||||| |||| |
|
|
| T |
46009155 |
tcgacgtgggatatgctcct |
46009136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 78 - 143
Target Start/End: Complemental strand, 13114210 - 13114145
Alignment:
| Q |
78 |
ggaactactgttgaaattcttgaaatttggggaggagtttccaaattaggtagtgaacccatttcc |
143 |
Q |
| |
|
||||| || |||| ||| |||||| ||||| |||||||||||||| ||||||| |||| ||||||| |
|
|
| T |
13114210 |
ggaacaacagttgtaatccttgaactttggtgaggagtttccaaactaggtagcgaactcatttcc |
13114145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University