View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20463_low_50 (Length: 216)
Name: NF20463_low_50
Description: NF20463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20463_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 28451504 - 28451325
Alignment:
| Q |
20 |
gcagatggaatatgtcttctcttcgctcttccttaccttcaattcctcctagttccgcttcttcattgcgcttcactcgttcttctccaactacactccg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28451504 |
gcagatggaatatgtcttctcttcgctcttccttaccttcaattcctcctacttccgcttcttcattgcgcttcactcgttcttctccaacaacactccg |
28451405 |
T |
|
| Q |
120 |
aatttctagacccaaatcccaatcactatttccctctttcactggacttcgtcctctcccaatcttcgctcctccatcag |
199 |
Q |
| |
|
|||||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28451404 |
aatttctagagtcaaatcccaatccctacttccctctttcactggacttcgtcctctcccaatcttcgctcctccatcag |
28451325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University