View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20464_high_23 (Length: 364)

Name: NF20464_high_23
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20464_high_23
NF20464_high_23
[»] chr8 (1 HSPs)
chr8 (156-346)||(41749568-41749758)


Alignment Details
Target: chr8 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 156 - 346
Target Start/End: Original strand, 41749568 - 41749758
Alignment:
156 atatttctcatgtccctcttcnnnnnnngtgaccaaaagggaaaatcaacaacgttatctactaacatagcaaaacaaatcaacaaagttaaaaacctca 255  Q
    |||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41749568 atatttctcatgtccctcttctttttttgtgaccaaaagggaaaatcaacaacgttatctactaacatagcaaaacaaatcaacaaagttaaaaacctca 41749667  T
256 aggaaacacaatcccaaaattatctactaacatagcaaaataattgaaatatgccagtaaattaaaaaccgagctactccattgggagtta 346  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41749668 aggaaacacaatcccaaaattatctactaacatagcaaaataattgaaatatgccagtaaattaaaaaccgagctactccattgggagtta 41749758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University