View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20464_high_41 (Length: 258)

Name: NF20464_high_41
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20464_high_41
NF20464_high_41
[»] chr4 (1 HSPs)
chr4 (174-249)||(6624775-6624850)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 174 - 249
Target Start/End: Complemental strand, 6624850 - 6624775
Alignment:
174 cttttaaaaatgtgcaatgtatatgggcacacaattctcccttttctattgattgatgcatatattcgagaataat 249  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6624850 cttttaaaaatgtgcaatgtatatgggcacacaattctcccttttctattgattgatgcatatattcgagaataat 6624775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University