View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20464_high_44 (Length: 250)
Name: NF20464_high_44
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20464_high_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 48020523 - 48020371
Alignment:
| Q |
5 |
gagaagcaaaggcagctggtgaaagtggtaaagttgatcattttcaacctcatcctgtcaaagaacaacttactgttgattgctgtgttaggagctcacc |
104 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020523 |
gagaaacaatggcagctggtgaaagtggtaaagttgatcattttcaacctcatcctgtcaaagaacaacttactgttgattgctgtgttaggagctcacc |
48020424 |
T |
|
| Q |
105 |
ttcatggcgtaagtcacccattttgttgtaatttgcttttcatgtaataccca |
157 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020423 |
ttcatggcgtaagtaacccattttgttgtaatttgcttttcatgtaataccca |
48020371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University