View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20464_high_45 (Length: 249)
Name: NF20464_high_45
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20464_high_45 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 14179935 - 14180174
Alignment:
| Q |
11 |
atgaaggatttacagtttgatgacttgagtaaaattgaacatgaattagagatctctcttgcaaaagttcgaaaccgtcaggttagtcgaaattaattta |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14179935 |
atgaaagatttacagtttgatgacttgagtaaaattgaacatgaattagagatctctcttgcaaaagttcgaaaccgtcaggttagtcgaaattaattta |
14180034 |
T |
 |
| Q |
111 |
tctattgtacctatagtaattacagtttatttcatcttcaatatttatgaaatttgattaatgtggcttttgttttattcaaaat-aaataaactttcat |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14180035 |
tctattgtacctgtagtaattacagtttatttcatcttcaatatttatgaaatttgattaatgtggcttttgttttattcaaaataaaataaactttcat |
14180134 |
T |
 |
| Q |
210 |
atgtctattgccttttgcttcaactttcatattctaaatc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14180135 |
atgtctattgccttttgcttcaactttcatattctaaatc |
14180174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 96050 - 95871
Alignment:
| Q |
11 |
atgaaggatttacagtttgatgacttgagtaaaattgaacatgaattagagatctctcttgcaaaagttcgaaaccgtcaggttagtcgaaattaattta |
110 |
Q |
| |
|
||||||| ||||| |||||||||||||| ||||||||||||||||||||| || |||||||| ||||||||||| || |||||||||| |||||| |||| |
|
|
| T |
96050 |
atgaaggctttacggtttgatgacttgactaaaattgaacatgaattagaaatatctcttgctaaagttcgaaagcgccaggttagtcaaaattatttta |
95951 |
T |
 |
| Q |
111 |
tctattgtacctatagtaattacagtttatttcatcttcaatatttatgaaatttgattaatgtggcttttgttttattcaaaa |
194 |
Q |
| |
|
|||||| || | |||||||| |||||||||| ||||||||||| ||||| |||||| ||| |||||||| |||||||||||| |
|
|
| T |
95950 |
tctattcta--tctagtaatt--agtttatttcttcttcaatattcatgaactttgatcaatttggcttttattttattcaaaa |
95871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University