View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20464_high_48 (Length: 231)
Name: NF20464_high_48
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20464_high_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 26 - 213
Target Start/End: Original strand, 38932026 - 38932213
Alignment:
| Q |
26 |
tgaatcatttatatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagtt |
125 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932026 |
tgaatgatttatatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagtt |
38932125 |
T |
 |
| Q |
126 |
tattggaagtgtcgaggagagtgacaataataagcggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932126 |
tattggaagtgtcgaggagagtgacaataataagaggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaat |
38932213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University