View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20464_low_26 (Length: 364)
Name: NF20464_low_26
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20464_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 156 - 346
Target Start/End: Original strand, 41749568 - 41749758
Alignment:
| Q |
156 |
atatttctcatgtccctcttcnnnnnnngtgaccaaaagggaaaatcaacaacgttatctactaacatagcaaaacaaatcaacaaagttaaaaacctca |
255 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41749568 |
atatttctcatgtccctcttctttttttgtgaccaaaagggaaaatcaacaacgttatctactaacatagcaaaacaaatcaacaaagttaaaaacctca |
41749667 |
T |
 |
| Q |
256 |
aggaaacacaatcccaaaattatctactaacatagcaaaataattgaaatatgccagtaaattaaaaaccgagctactccattgggagtta |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41749668 |
aggaaacacaatcccaaaattatctactaacatagcaaaataattgaaatatgccagtaaattaaaaaccgagctactccattgggagtta |
41749758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University