View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20464_low_41 (Length: 268)
Name: NF20464_low_41
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20464_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 168 - 256
Target Start/End: Complemental strand, 48020104 - 48020016
Alignment:
| Q |
168 |
gaaaactgtaggtggaaaaagctgaaatgattcaaacactgctttttgttgctggaatcaacactctgttgcagacatggcttggaact |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020104 |
gaaaactgtaggtggaaaaagctgaaatgattcaaacactgctttttgttgctggaatcaacactctgttgcagacatggcttggaact |
48020016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 48020270 - 48020198
Alignment:
| Q |
1 |
taatgcttggaaccattgtcattgtttccactattcttgttcctttgatgggtggtggcaatgtaatcatcaa |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020270 |
taatgcttggaaccattgtcattgtttccactattcttgttcctttgatgggtggtggcaatgtaatcatcaa |
48020198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University