View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20464_low_41 (Length: 268)

Name: NF20464_low_41
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20464_low_41
NF20464_low_41
[»] chr1 (2 HSPs)
chr1 (168-256)||(48020016-48020104)
chr1 (1-73)||(48020198-48020270)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 168 - 256
Target Start/End: Complemental strand, 48020104 - 48020016
Alignment:
168 gaaaactgtaggtggaaaaagctgaaatgattcaaacactgctttttgttgctggaatcaacactctgttgcagacatggcttggaact 256  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48020104 gaaaactgtaggtggaaaaagctgaaatgattcaaacactgctttttgttgctggaatcaacactctgttgcagacatggcttggaact 48020016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 48020270 - 48020198
Alignment:
1 taatgcttggaaccattgtcattgtttccactattcttgttcctttgatgggtggtggcaatgtaatcatcaa 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48020270 taatgcttggaaccattgtcattgtttccactattcttgttcctttgatgggtggtggcaatgtaatcatcaa 48020198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University