View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20464_low_43 (Length: 264)
Name: NF20464_low_43
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20464_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 5 - 248
Target Start/End: Original strand, 3830718 - 3830959
Alignment:
| Q |
5 |
cagagcactacttatttctcaactgctccttttttctatatttctcttatctgtacatctcatatccacttcttcgtttgtttacttctcacttttcgta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3830718 |
cagagcactacttatttctcaactgctccttttttctatatttctcttatctgtacatctcatatccacttcttcgtttgtttacttctcacttttcgta |
3830817 |
T |
 |
| Q |
105 |
gattttgtgataaacaatatatctgtggacattaaaagaaaaatccataaacaatctggatagtatgcgacttatcttctttgtacatcatagaacaatc |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3830818 |
gattttgtgataaacaatatatttgtggacat--aaagaaaagtccataaacaatgtggatagtatgcgacttatcttctttgtacatcatagaacaatc |
3830915 |
T |
 |
| Q |
205 |
aatccatcataattgacatcaaaaggatcttagccccaacaaaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3830916 |
aatccatcataattgacatcaaaaggatcttagccccaacaaaa |
3830959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University