View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20464_low_55 (Length: 227)
Name: NF20464_low_55
Description: NF20464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20464_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 33614740 - 33614869
Alignment:
| Q |
1 |
agtgtgcaattctctcagacaaatgcctcgttttgtcctcacaattgttttgaatggatttcatcagacacgtcatcgttttgatcatcactgagaattc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33614740 |
agtgtggaattctctcagacaaatgcctcgttttgtcctcacaattgttttgaatggatttcatcagactcgtcatcgttttgatcatcactgagaattc |
33614839 |
T |
 |
| Q |
101 |
cacatctgagtttctattaattcaacataa |
130 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
33614840 |
cacatctgaatttctattaattcaacataa |
33614869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 29160051 - 29159931
Alignment:
| Q |
1 |
agtgtgcaattctctcagacaaatgcctcgttttgtcctcacaattgttttgaatgg--atttcatcagacacgtcatcgttttgatcatcactgagaat |
98 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
29160051 |
agtgtggaattctctcagacaaatgcctcgttttgtcctcacaattgttttgaatggaaatttcatcagactcgtcatcgttttaatcatcactgagaat |
29159952 |
T |
 |
| Q |
99 |
tccacatctgagtttctatta |
119 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
29159951 |
accacatctgagttcctatta |
29159931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University