View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20465_high_13 (Length: 220)
Name: NF20465_high_13
Description: NF20465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20465_high_13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 18296451 - 18296670
Alignment:
| Q |
1 |
cttccagttgttctttaaattcccttatgttattcaaatttggtgttggtttgccacaatcatcaacactactttgcaatttacatctcttgaaaatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18296451 |
cttccagttgttctttaaattcccttatgctattcaaatttggtgttggtttgccacaatcatcaacactactttgcaatttacatctcttgaaaatatt |
18296550 |
T |
 |
| Q |
101 |
tcgaagctttcccacaaatcatggacacctcaatgcaaagggaaattacttctattttagtaaacattttcaatgttatcagaaaccaataaagatttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18296551 |
tcgaagctttcccacaaatcatggacacctcaatgcaaagggaaattacttctattttagtaaacattttcaatgttatcagaaaccaataaagatttaa |
18296650 |
T |
 |
| Q |
201 |
ttaatgatgggaagattacc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18296651 |
ttaatgatgggaagattacc |
18296670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University