View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20465_high_2 (Length: 690)
Name: NF20465_high_2
Description: NF20465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20465_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 1e-95
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 683924 - 684113
Alignment:
| Q |
1 |
cgatgttgctgacacctttgaggttagaatttctactatggatttacctcccctgcagtcaaattacacgcattagggacattagtgatcgttcaatcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
683924 |
cgatgttgctgacacctttgaggttagaatttctactatggatttacctcccctgcagtcaaattacacgcattcgggacattagtgatcgttcaatcga |
684023 |
T |
|
| Q |
101 |
gatcggacaaactaaattcaaactcattagtttaaatgatcaatatcggacgatcatcaatgttccgaacgggtgaatgtgtggtccttt |
190 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
684024 |
gatcagacaaactaaattcaaactcattagtttaaatgatcaatatcggacgatcatcaatgttcggaacgggtgaatgtgtggtccttt |
684113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 537 - 591
Target Start/End: Complemental strand, 13486397 - 13486343
Alignment:
| Q |
537 |
gtggttagtcatctcctcatggccctaatttcttttcgtgaaaaattgccttata |
591 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13486397 |
gtggttagtcatctactcatggccctaatttcttttcgtgaaaaatggccttata |
13486343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University