View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20465_low_15 (Length: 227)
Name: NF20465_low_15
Description: NF20465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20465_low_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 44 - 227
Target Start/End: Complemental strand, 54380837 - 54380646
Alignment:
| Q |
44 |
taaaaagaagcatacttataaatcacacaatcaagatgattctcacaaa-----atatggtgcttcatatgcctcaattgcacacctacaaaatcaaagt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54380837 |
taaaaagaagcatacttataaatcacacaatcaagatgattctcacaaatcggaatatggtgcttcatatgcctcaattgcaaacctacaaaatcaaagt |
54380738 |
T |
 |
| Q |
139 |
ttgaaattctacaaactacaaacccaatttacctaattttaccctcgtcttacagggc---gaaacacaggatcacaaggaaatgggtaaac |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54380737 |
ttgaaattctacaaactacaaacccaatttacctaattttaccctcgtcttacagggcacagaaacacaggatcacaaggaaatgggtaaac |
54380646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University