View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20465_low_18 (Length: 211)
Name: NF20465_low_18
Description: NF20465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20465_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 54380669 - 54380487
Alignment:
| Q |
20 |
aggatcacaaggaaatgggtaaaccttacataattgtgcatatggtattaattaaagggtgggtcaaacctaatcttacactaatccatcttcagttaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54380669 |
aggatcacaaggaaatgggtaaaccttacataattgtgcatatggtattaataaaagggtgggtcaaacctaatcttacactaatccatcttcagttaca |
54380570 |
T |
|
| Q |
120 |
aaagggtggca---tat-----aaaacaataaaacaataaaacaccaaagcatcactaactgaaaacttagaagtgttgcatc |
194 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54380569 |
aaagggtggcacggtatctttgtgggatataaaacaataaaacaccaaagcatcactaactgaaaacttagaagtgttgcatc |
54380487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University