View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20466_high_6 (Length: 255)
Name: NF20466_high_6
Description: NF20466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20466_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 238
Target Start/End: Complemental strand, 34349476 - 34349251
Alignment:
| Q |
13 |
atactgcgattgatgagagagctaactagtttggtgctttttcaaatattcccttcctaaagagaatacgtgaggagcacctcaatatggcaacttagtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34349476 |
atactgcgattgatgagagagctaactagtttggtgctttttcaaatattcccttcctaaagagaatacgcgaggagcacctcaatatggcaacttagtg |
34349377 |
T |
 |
| Q |
113 |
ggagaatgagggaaataatctgatacagtggtgtgtgagagctttcttgctttatttgatttgttttactatattcatcgacaatatcaacaagcacatt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34349376 |
ggagaatgagggaaataatccgatacaatggtgtgtgagagctttcttgctttatttgatttgttttactatattcatcgacaatatcaacaagcacatt |
34349277 |
T |
 |
| Q |
213 |
gacattatatcgcttgataagggagt |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34349276 |
gacattatatcgcttgataagggagt |
34349251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 120
Target Start/End: Original strand, 16782360 - 16782424
Alignment:
| Q |
56 |
aaatattcccttcctaaagagaatacgtgaggagcacctcaatatggcaacttagtgggagaatg |
120 |
Q |
| |
|
||||||||| |||||||| ||||| ||| |||||||||||||||| |||| ||| |||||||| |
|
|
| T |
16782360 |
aaatattccactcctaaagggaatatatgacgagcacctcaatatggaaactcagttggagaatg |
16782424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University