View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20466_low_4 (Length: 310)
Name: NF20466_low_4
Description: NF20466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20466_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 20 - 303
Target Start/End: Complemental strand, 25575661 - 25575378
Alignment:
| Q |
20 |
accagacaccctccacttatctctttggtggctcatcaataaagcatctccatttgactgcggaatcacccaagaaccccatccagactcaatgtcatct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25575661 |
accagacaccctccacttatctctttggtggctcatcaataaagcatctccatttgactgcggaatcacccaagaaccccatccagactcaatgtcatct |
25575562 |
T |
|
| Q |
120 |
tcaactctgcgctttttgtctattttatcagcatgctcatcatccaatctgttatattttctccgcaacgagtgttctttcctacaattttgcatcttat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25575561 |
tcaactctgcgctttttgtctattttatcagcatgctcatcatccaatctgttatattttctccgcaacgagtgttctttcctacaattttgcatcttat |
25575462 |
T |
|
| Q |
220 |
gacctgcttctccacgtctataaccagtatgctttaattttgaactgtttgggcgattcaaggtttcctcaccaatctgtgctc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25575461 |
gacctgcttctccacgtctataaccagtatgctttaattttgaactgtttgggcggttcaaggtttcctcaccaatctgtgctc |
25575378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University