View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20467_high_22 (Length: 215)
Name: NF20467_high_22
Description: NF20467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20467_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 208
Target Start/End: Original strand, 43476364 - 43476557
Alignment:
| Q |
14 |
agaaacatctactcatgaccaagataagatgacctctatccgcactcttattgttgttgcatatgttcgtcaatggcatatttctcgtaatcatgggaga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43476364 |
agaaacatctactcatgaccaagataagatgacctctatccacactcttattgttgttgcatatgttcgtcaatggcacatttctcgtaatcatgggaga |
43476463 |
T |
|
| Q |
114 |
agtcaaaggggaaaaatgtctttctaaataaaccagcgaagatgttcgtcaatagtattctcctaatatagacccctttttaaatgatattcttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
43476464 |
agtcaaaggggaaaaatgtctttctaaat-aaccagcgaagatgtccgtcaatagtattctcctaatatagacacctttttaaatgataatcttc |
43476557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 97
Target Start/End: Complemental strand, 47937492 - 47937437
Alignment:
| Q |
42 |
atgacctctatccgcactcttattgttgttgcatatgttcgtcaatggcatatttc |
97 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||| | | ||||| ||||||||||| |
|
|
| T |
47937492 |
atgaccactatccgcactcttattgctgttgcatctatacgtcagtggcatatttc |
47937437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University