View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20467_high_3 (Length: 557)
Name: NF20467_high_3
Description: NF20467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20467_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 8e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 14567300 - 14567433
Alignment:
| Q |
10 |
agaagcaaaggtgagatggcagtggctaaagtgatnnnnnnnnnttacacaaacaagacaagtggatttagtcttgcacattccaaagtcaaaattcaaa |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14567300 |
agaagtaaaggtgagatggcagtggctaaagtgataaaataaaattacacaaacaagacaagtggatttagtcttgcacattccaaagtcaaaattcaaa |
14567399 |
T |
 |
| Q |
110 |
----tatacaaaattgatttcaatttattaagaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14567400 |
taagtatacaaaattgatttcaatttattaagaa |
14567433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 236 - 295
Target Start/End: Complemental strand, 24210876 - 24210817
Alignment:
| Q |
236 |
tagaccagggcttattagagttctcaagattgtaggactcgccgtctaagaaataaggaa |
295 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
24210876 |
tagacaagggtttattagggttctcaagattgtaggactcacaatcaaagaaataaggaa |
24210817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University