View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20467_low_15 (Length: 343)
Name: NF20467_low_15
Description: NF20467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20467_low_15 |
 |  |
|
| [»] scaffold1694 (1 HSPs) |
 |  |  |
|
| [»] scaffold0354 (1 HSPs) |
 |  |  |
|
| [»] scaffold1074 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-172; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 25048556 - 25048880
Alignment:
| Q |
1 |
aacgcatatattaattttgaggattatcgacttaattgactgatctaagaaattagggttcatcccaaagtaggactgattcattttcgattagacacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25048556 |
aacgcatatattaattttgaggattatcgacttaattgactgatctaagaaattagggttcatcccaaagtaggactgattcattttcgattagatacaa |
25048655 |
T |
 |
| Q |
101 |
gtttggttcgggcttgatcaattaagagaagtccttgttaaatttgatgaatcattgatctattaagggagattatatatcgaaaattagttgttaaccg |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25048656 |
gtttggttcgggctcgatcaattaagagaagtccttgttaaatttgatgaatcattgatccattaagggagatcatatatcgaaaattagttgttaaccg |
25048755 |
T |
 |
| Q |
201 |
aatccgtaagaacggaaaaaattatgggtttttcccaaaacaatttcaagaatggcaattgtaattttttgggtggtatccggggttcgaacctcagacc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25048756 |
aatccgtaagaacggaaaaaattatgggtttttcccaaaacaatttcaagaatggcaattgtaattttttgggtggtattcggggttcgaacctcagacc |
25048855 |
T |
 |
| Q |
301 |
ttgcatatattttttgggtggtatc |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
25048856 |
ttgcatatattttttgggtggtatc |
25048880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 9 - 66
Target Start/End: Original strand, 23891773 - 23891830
Alignment:
| Q |
9 |
tattaattttgaggattatcgacttaattgactgatctaagaaattagggttcatccc |
66 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
23891773 |
tattaattttgagaattatcgacttaattgacagatgtaaggaattagggttcatccc |
23891830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 273 - 311
Target Start/End: Complemental strand, 24393316 - 24393278
Alignment:
| Q |
273 |
gtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24393316 |
gtggtgtccggggttcgaacctcagaccttgcatatatt |
24393278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 273 - 311
Target Start/End: Complemental strand, 34903588 - 34903550
Alignment:
| Q |
273 |
gtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34903588 |
gtggtgtccggggttcgaacctcagaccttgcatatatt |
34903550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 264 - 311
Target Start/End: Complemental strand, 27152433 - 27152386
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
27152433 |
atttttttggtggtgtcctgggttcgaaccccagaccttgcatatatt |
27152386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 311
Target Start/End: Original strand, 2939766 - 2939811
Alignment:
| Q |
266 |
tttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| |||| | ||||||||||||||| ||||||||||||||||| |
|
|
| T |
2939766 |
ttttttggtgatgtccggggttcgaaccccagaccttgcatatatt |
2939811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Original strand, 3243361 - 3243409
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
3243361 |
atttttttggtggtgtccggggttcgaacccgcgaccttgcatatattt |
3243409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 272 - 311
Target Start/End: Complemental strand, 3222803 - 3222764
Alignment:
| Q |
272 |
ggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3222803 |
ggtggtatccggggttcgaacctcagaccttgcatatatt |
3222764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 2530091 - 2530043
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
2530091 |
atttttttggtggtgtccggggttcgaacctgcgaccttgcatatattt |
2530043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 264 - 311
Target Start/End: Complemental strand, 11017256 - 11017209
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||| || ||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
11017256 |
atttttttggcggtgtccgggattcgaacctcagaccttgcatatatt |
11017209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 311
Target Start/End: Complemental strand, 22499020 - 22498975
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
22499020 |
ttttttggatggtgtccggggttcgaacc-cagaccttgcatatatt |
22498975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 266 - 312
Target Start/End: Original strand, 31958451 - 31958497
Alignment:
| Q |
266 |
tttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||| |||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
31958451 |
ttttttggtggtgtccggggttcgaaccccggaccttgcatatattt |
31958497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 311
Target Start/End: Original strand, 31708129 - 31708174
Alignment:
| Q |
266 |
tttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| |||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
31708129 |
ttttttggtggtgtccgaggttcgaaccccagaccttgcatatatt |
31708174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Original strand, 790127 - 790175
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| | |||||||||||||| |||||||||||||||| |
|
|
| T |
790127 |
atttttttggtggtgttcggggttcgaacctgcgaccttgcatatattt |
790175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 12)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 9 - 69
Target Start/End: Complemental strand, 33362412 - 33362352
Alignment:
| Q |
9 |
tattaattttgaggattatcgacttaattgactgatctaagaaattagggttcatcccaaa |
69 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
33362412 |
tattaattttgagaattatcgaattaattgacagatgtaacgaattagggttcatcccaaa |
33362352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 311
Target Start/End: Complemental strand, 3580793 - 3580747
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||| |||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
3580793 |
tttttttggtggtgtccggggttcgaatcccagaccttgcatatatt |
3580747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 311
Target Start/End: Original strand, 11144647 - 11144693
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||| |||||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
11144647 |
tttttttggtggtgtccggggttcaaaccccagaccttgcatatatt |
11144693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 273 - 311
Target Start/End: Complemental strand, 11166757 - 11166719
Alignment:
| Q |
273 |
gtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
11166757 |
gtggtgtccggggttcgaaccttagaccttgcatatatt |
11166719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 311
Target Start/End: Original strand, 43034324 - 43034370
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43034324 |
tttttttggtggtggccggggtttgaacctcagaccttgcatatatt |
43034370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 311
Target Start/End: Original strand, 47806238 - 47806284
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||| |||||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
47806238 |
tttttttggtggtgttcggggttcgaaccccagaccttgcatatatt |
47806284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 310
Target Start/End: Original strand, 11314639 - 11314684
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatat |
310 |
Q |
| |
|
|||||| |||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
11314639 |
tttttttggtggtgtccggggtttgaacctcggaccttgcatatat |
11314684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 311
Target Start/End: Original strand, 19124622 - 19124650
Alignment:
| Q |
283 |
gggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19124622 |
gggttcgaacctcagaccttgcatatatt |
19124650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 20681202 - 20681154
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
20681202 |
atttttttggtggtgtccggggtttgaacctgcgaccttgcatatattt |
20681154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 311
Target Start/End: Complemental strand, 44221508 - 44221480
Alignment:
| Q |
283 |
gggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44221508 |
gggttcgaacctcagaccttgcatatatt |
44221480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 49125552 - 49125504
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
49125552 |
atttttttggtggtgtccggggttcgaacccgcgaccttgcatatattt |
49125504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 51187624 - 51187576
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
51187624 |
atttttttggtggtgtccggggttcgaacccgggaccttgcatatattt |
51187576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 12)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 311
Target Start/End: Original strand, 35778183 - 35778229
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35778183 |
tttttttggtggtggccggggttcgaacctcagaccttgcatatatt |
35778229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 265 - 312
Target Start/End: Original strand, 24473619 - 24473666
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
24473619 |
ttttttgggtggtgtccggggttcgaacccgcgaccttgcatatattt |
24473666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 43124362 - 43124311
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatatttttt |
315 |
Q |
| |
|
||||||| ||||| | |||||||||||||| |||||||||||||||||||| |
|
|
| T |
43124362 |
attttttttgtggtgtacggggttcgaacctaagaccttgcatatatttttt |
43124311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 311
Target Start/End: Complemental strand, 3481640 - 3481594
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
3481640 |
ttttttgggtggtggccggggtttgaaccccagaccttgcatatatt |
3481594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 266 - 312
Target Start/End: Original strand, 23730362 - 23730408
Alignment:
| Q |
266 |
tttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||| |||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
23730362 |
ttttttggtggtgtccggggttcgaaccccggaccttgcatatattt |
23730408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 311
Target Start/End: Original strand, 41950082 - 41950112
Alignment:
| Q |
281 |
cggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41950082 |
cggggttcgaacctcagaccttgcatatatt |
41950112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 311
Target Start/End: Original strand, 47528429 - 47528475
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| |||||||| |||||| |
|
|
| T |
47528429 |
tttttttggtggtgtccggggttcgaacctcggaccttgcgtatatt |
47528475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 311
Target Start/End: Complemental strand, 4859161 - 4859116
Alignment:
| Q |
266 |
tttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| ||||||||| |||||||||||| |||||||| |||||||| |
|
|
| T |
4859161 |
ttttttggtggtatcaggggttcgaaccccagaccttacatatatt |
4859116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 310
Target Start/End: Complemental strand, 21638192 - 21638147
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatat |
310 |
Q |
| |
|
|||||| |||||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
21638192 |
tttttttggtggtgtccggggttcgaaccccggaccttgcatatat |
21638147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 279 - 311
Target Start/End: Original strand, 28039856 - 28039888
Alignment:
| Q |
279 |
tccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
28039856 |
tccggggttcaaacctcagaccttgcatatatt |
28039888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 311
Target Start/End: Complemental strand, 29251815 - 29251787
Alignment:
| Q |
283 |
gggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29251815 |
gggttcgaacctcagaccttgcatatatt |
29251787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Original strand, 46040552 - 46040600
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
46040552 |
atttttttggtggtgtccggggttcgaacccgggaccttgcatatattt |
46040600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 266 - 311
Target Start/End: Complemental strand, 46987164 - 46987119
Alignment:
| Q |
266 |
tttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
46987164 |
tttttgggtggtgtccggggttcgaaccccggaccttgcatatatt |
46987119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 273 - 312
Target Start/End: Original strand, 38049303 - 38049342
Alignment:
| Q |
273 |
gtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
38049303 |
gtggtgtccgggattcgaacctcagaccttgcatatattt |
38049342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 273 - 311
Target Start/End: Complemental strand, 25923462 - 25923424
Alignment:
| Q |
273 |
gtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25923462 |
gtggtatctggggttcaaacctcagaccttgcatatatt |
25923424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 311
Target Start/End: Original strand, 23069840 - 23069885
Alignment:
| Q |
266 |
tttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| |||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
23069840 |
ttttttggtggtgtccggggttcgaaccccataccttgcatatatt |
23069885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Original strand, 20135142 - 20135190
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
20135142 |
atttttttggtggtgtccggggttcgaacccgggaccttgcatatattt |
20135190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1694 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold1694
Description:
Target: scaffold1694; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 307
Target Start/End: Complemental strand, 234 - 192
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcata |
307 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
234 |
ttttttgggtggtagccgaggtttgaacctcagaccttgcata |
192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 311
Target Start/End: Original strand, 21865416 - 21865462
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||||||||| || ||||||| ||||| |||||||||||||||| |
|
|
| T |
21865416 |
ttttttgggtggtgtctggggttctaaccttagaccttgcatatatt |
21865462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Original strand, 6018640 - 6018688
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
6018640 |
atttttttggtggtgtccggggttcgaacccacgaccttgcatatattt |
6018688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 273 - 311
Target Start/End: Complemental strand, 14771402 - 14771364
Alignment:
| Q |
273 |
gtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
14771402 |
gtggtgtccgggattcgaacctcagaccttgcatatatt |
14771364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 273 - 311
Target Start/End: Original strand, 27397602 - 27397640
Alignment:
| Q |
273 |
gtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
27397602 |
gtggtgtccggggttcgaaccttagaccttgcatatatt |
27397640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 274 - 311
Target Start/End: Complemental strand, 20400147 - 20400110
Alignment:
| Q |
274 |
tggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
20400147 |
tggtatctggggtttgaacctcagaccttgcatatatt |
20400110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 274 - 311
Target Start/End: Complemental strand, 30200896 - 30200859
Alignment:
| Q |
274 |
tggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
30200896 |
tggtgtccggggttcgaacctcaaaccttgcatatatt |
30200859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 313
Target Start/End: Complemental strand, 51614289 - 51614240
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatatttt |
313 |
Q |
| |
|
||||||| ||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
51614289 |
attttttttgtggtgtccgggattcgaacctcggaccttgcatatatttt |
51614240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 311
Target Start/End: Original strand, 25505682 - 25505729
Alignment:
| Q |
263 |
aattttttgggtggtatccggggttcgaacctcagaccttgcatatatt |
311 |
Q |
| |
|
|||||||| |||||| |||||| |||||||| ||||||||||||||||| |
|
|
| T |
25505682 |
aatttttttggtggtgtccggg-ttcgaaccccagaccttgcatatatt |
25505729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 38361759 - 38361711
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
38361759 |
atttttttggtggtgtccggggttcgaacccgcgaccttgcatatattt |
38361711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Original strand, 41990830 - 41990878
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| | |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
41990830 |
atttttttgttggtgtccggggttcgaacctgcgaccttgcatatattt |
41990878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0354 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 302
Target Start/End: Original strand, 7202 - 7239
Alignment:
| Q |
265 |
ttttttgggtggtatccggggttcgaacctcagacctt |
302 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
7202 |
ttttttgggtggtgtccggggttcgaaccccagacctt |
7239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1074 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold1074
Description:
Target: scaffold1074; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 703 - 639
Alignment:
| Q |
5 |
catatattaattttgaggattatcgacttaattgactgatctaagaaattagggttcatcccaaa |
69 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| ||| ||| ||| || ||||||||||| |||| |
|
|
| T |
703 |
catatatcaattttgagaattatcgacttaatcgacagatgtaaagaaatagggttcatcacaaa |
639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 38139319 - 38139271
Alignment:
| Q |
264 |
attttttgggtggtatccggggttcgaacctcagaccttgcatatattt |
312 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
38139319 |
atttttttggtggtgtccggggttcgaacccacgaccttgcatatattt |
38139271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University