View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20467_low_23 (Length: 235)
Name: NF20467_low_23
Description: NF20467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20467_low_23 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 23 - 235
Target Start/End: Original strand, 14450028 - 14450240
Alignment:
| Q |
23 |
atatagcatttattaattatatatttgagacttgttttgatttaggaaattcatgttagaaattgtctccttaaacaacacatttcgatttagacagtaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14450028 |
atatagcatttattaattatatatttgagacttgttttgatttaggaaattcatgttagaaattgtctccttaaacaacacatttcgatttagacagtaa |
14450127 |
T |
 |
| Q |
123 |
atgcaagggaaattaagatcaaaaaccgtgagtgtacctacccaagaacacgtatggtcgccttaaacaacccatttttatttcattctataactagtta |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14450128 |
atgcaagggaaattaagatccaaaaccgtgagtgcacctacccaaaaacacgtatggtctccttaaacaacccatttttatttcattctataactagtta |
14450227 |
T |
 |
| Q |
223 |
aaaacttgtgcga |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14450228 |
aaaacttgtgcga |
14450240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University