View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20467_low_7 (Length: 434)
Name: NF20467_low_7
Description: NF20467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20467_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 55 - 135
Target Start/End: Complemental strand, 30590672 - 30590592
Alignment:
| Q |
55 |
aattcctcctttgaacccttgagaaatgcatttcactttgtctacctgaagtagaacttagactttgggattccggtcaat |
135 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| ||||| ||||| |||||||||||||||||||||| ||||| |
|
|
| T |
30590672 |
aattcctcctttgaaccgttgagcaatgcatttcactttatctacaagaagtggaacttagactttgggattccgatcaat |
30590592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 2e-19; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 324 - 397
Target Start/End: Original strand, 9152109 - 9152182
Alignment:
| Q |
324 |
ggagtctcccggatcaattttgtccgtggtgtgaaagtggtggtatgttttccatgaacttgttgacttcataa |
397 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||| ||| ||||| ||||| ||||||| |
|
|
| T |
9152109 |
ggagtctcccggatcaattttgtccatggtgtgaaggtggtggtatgtttcccacgaactagttgatttcataa |
9152182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 214 - 270
Target Start/End: Original strand, 9151996 - 9152052
Alignment:
| Q |
214 |
aaaacactagaacagcatgactaacacaacaataactaatcataacaagcttgactc |
270 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9151996 |
aaaacactagaacagcatgactaacaaaacaataactaatcgtaacaagcttgactc |
9152052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 23 - 86
Target Start/End: Original strand, 9151928 - 9151994
Alignment:
| Q |
23 |
tagcaaatcagatgattttcttatttct---tgtcaattcctcctttgaacccttgagaaatgcatt |
86 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
9151928 |
tagcacatcagatgattttcttatttcttcttgtcaattcctcctttgaacccttaagaaatacatt |
9151994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 54 - 99
Target Start/End: Original strand, 30698184 - 30698229
Alignment:
| Q |
54 |
caattcctcctttgaacccttgagaaatgcatttcactttgtctac |
99 |
Q |
| |
|
|||||||||||||| ||| ||| | ||||||||||||||||||||| |
|
|
| T |
30698184 |
caattcctcctttggaccgttgtgcaatgcatttcactttgtctac |
30698229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University