View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20468_high_2 (Length: 233)
Name: NF20468_high_2
Description: NF20468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20468_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 25813980 - 25813777
Alignment:
| Q |
16 |
atatgtctgcatttgtagagtttcttttgaaaccacaactcagttaatgatgttcttcccttgccatgattctcaacattaccagaaaagatgtttagta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813980 |
atatgtctgcatttgtagagtttcttttgaaaccacaactcagttaatgatgttcttcccttgccatgattctcaacattaccagaaaagatgtttagta |
25813881 |
T |
 |
| Q |
116 |
tcgctagcgtatactttgctccatcgtgaccttgttgtaaggccatttctagaaaatttctagcagaatcatagtttgaaatttgatagcaaatatctag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813880 |
tcgctagcgtatactttgctccatcgtgaccttgttgtaaggccatttctagaaaatttctagtagaatcatagtttgaaatttgatagcaaatatctag |
25813781 |
T |
 |
| Q |
216 |
gata |
219 |
Q |
| |
|
|||| |
|
|
| T |
25813780 |
gata |
25813777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University