View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_high_2 (Length: 642)
Name: NF20469_high_2
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 1e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 12 - 134
Target Start/End: Complemental strand, 40273767 - 40273645
Alignment:
| Q |
12 |
aagaatatgatgcattatgtcttttgttgcttttattcttcaaagttgtactaaatgtcatggttcaagaaaatttagatcttgggtaaactaaaaaact |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40273767 |
aagaaaatgatgcattatgtcttttgttgcttttattcttcaaagttgtactaaatgtcatggttcaagaaaatttagatcttgggtaaattaaaaaact |
40273668 |
T |
|
| Q |
112 |
cgaagagttagagagggttttga |
134 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
40273667 |
cgaagagttagggagggttttga |
40273645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 40274462 - 40274589
Alignment:
| Q |
7 |
tgtcgaagaatatgatgcattatgtcttttgttgcttttattcttcaaagttgtactaaatgtcatggttcaagaaaatttagatcttgggtaaactaaa |
106 |
Q |
| |
|
|||| ||||| | ||||||| ||||| |||||| ||||||| ||||||||| || | ||||| ||||||||||||||||||||| || || |||||||| |
|
|
| T |
40274462 |
tgtcaaagaagacgatgcatattgtctcttgttgtttttatttttcaaagttatatttaatgtgatggttcaagaaaatttagatattaggaaaactaaa |
40274561 |
T |
|
| Q |
107 |
aaactcgaagagttagagagggttttga |
134 |
Q |
| |
|
||| | | ||||||| ||||| ||||| |
|
|
| T |
40274562 |
aaatttggagagttatggaggggtttga |
40274589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 40273138 - 40273098
Alignment:
| Q |
141 |
attgtgtgtctatttatattatgttcttcctagcgcaatat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40273138 |
attgtgtgtctatttatattatgttcttcctagcacaatat |
40273098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 529 - 581
Target Start/End: Original strand, 34860147 - 34860199
Alignment:
| Q |
529 |
gcctagttgcacccttccattgtgctttaaataaaggtcctctttaagctgca |
581 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| | |||||||||| ||||||| |
|
|
| T |
34860147 |
gcctagttgcatccttccaccgtgctttaaatgatggtcctctttcagctgca |
34860199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University