View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_high_23 (Length: 383)
Name: NF20469_high_23
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 20 - 346
Target Start/End: Original strand, 28485405 - 28485731
Alignment:
| Q |
20 |
cttgaaatggaggagaagatggctggctcagttgaatcaacagaatgtcggttccgaggatgcggttcttcccgatcaatcatctgcagccactcatcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28485405 |
cttgaaatggaggagaagatggcttgctcagttgaatcaacagaatgtcggttccgaggatgcggttcttcccgatcaatcatctgcagccactcatcaa |
28485504 |
T |
 |
| Q |
120 |
gttcaaattgattctcaacatactgagagtaatgtgggcaactctcctaggcaaatgagctgacagaatacatttttcatattttctcgaatgctggcat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28485505 |
gttcaaattgattctcaacatactgagagtaatgtgggcaactctcctaggcaaatgagctgacagaatacatttttcatattttctcgaatgctagcat |
28485604 |
T |
 |
| Q |
220 |
cattaaggtgtctgagtagcataaagttcatattgcataggcaaatttgagcacattattttcttgtatgtttaggaacagaaatttatcatgtgtgatt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28485605 |
cattaaggtgtctgagtagcataaagttcatattgtataggcaaatttgagcacattattttcttgtatgtttaggaacagaaatttatcatgtgtgatt |
28485704 |
T |
 |
| Q |
320 |
tctgaaatctctcatcagaaacaaaga |
346 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28485705 |
tctgaaatctctcatcagaaacaaaga |
28485731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University