View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_high_31 (Length: 360)
Name: NF20469_high_31
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_high_31 |
 | |
|
| [»] scaffold0219 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 20 - 349
Target Start/End: Complemental strand, 11193 - 10864
Alignment:
| Q |
20 |
aacataaaatgcaaaaccttcgcacatcaccaacacttcatcaaatattctctaggatatgtcaatgtcgacaagaatgccagcgtagtacctaccctgc |
119 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11193 |
aacataaaatgcaaaaccttcgcgcatcaccaacacttcatcaaatattctctaggataggtcaatgtcgacaagaatgccagcgtagtacctaccccgc |
11094 |
T |
|
| Q |
120 |
ttgatatttcaaacaatgttcttggcagccaatattcttgggggaggtccatgattctgaacattggattgcctttgtgtgtaagggttgaaatcatgtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11093 |
ttgatatttcaaacaatgttcttggcagccaatattcttgggggaggtccatgattctgaacattggattgcctttgtgtgtaagggttgaaatcatgtt |
10994 |
T |
|
| Q |
220 |
cccactttgagaggcacaagaaatctggatgaagagagatcatcaacctccattggccaaaatccttctaaactgtctgcaacttcgacgagagatcaca |
319 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10993 |
cccactttgagaggcataagaaatctggatgaagagagatcatcaacctccattggccaaaatccttctaaactgtctgcaacttcgatgagagatcaca |
10894 |
T |
|
| Q |
320 |
agaggttaaagatttgtttcccttattcat |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10893 |
agaggttaaagatttgtttcccttattcat |
10864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 261 - 316
Target Start/End: Complemental strand, 15698022 - 15697967
Alignment:
| Q |
261 |
atcaacctccattggccaaaatccttctaaactgtctgcaacttcgacgagagatc |
316 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| ||| |||| ||||||||||||||| |
|
|
| T |
15698022 |
atcaacctccattgtccaaaatccttccaaattgtttgcagcttcgacgagagatc |
15697967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University