View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_high_35 (Length: 337)
Name: NF20469_high_35
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 19 - 327
Target Start/End: Original strand, 32361507 - 32361815
Alignment:
| Q |
19 |
aagatgtgagacactctttggtgttgttaaaggcacaaaggtagtggttgcaaaggttagagctgtctgcatttttgaagggtattgttaatgacctttt |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
32361507 |
aagatgtgagatactctttggtgttgttaaaggcacaaaggtagtggttgcaaaggttagagctgtctgcattttttaagggtattgttagtgacctttt |
32361606 |
T |
 |
| Q |
119 |
gagttgaattaatcttctaaggaaagtttggtttcgatttatagaataggaataggacacctatcactatagtggatgagatatttagtattcaggataa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32361607 |
gagttgaattaatcttctaaggaaagtttggtttcgatttatagaataggaataggatacctatcactatagtggatgagatatttagtattcaggataa |
32361706 |
T |
 |
| Q |
219 |
ggtttcctttttgtcttgggagatagattgtcctggctcacaaaataattgtgaatttcttggacctttacaatcactactagtccatgtttgtgtattc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32361707 |
ggtttcctttttgtcttgggagatagattgtcctggctcacaaaataattgtgaatttcttggacctttacaatcactactagtccatgtttgtgtattc |
32361806 |
T |
 |
| Q |
319 |
tctattctt |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
32361807 |
tctattctt |
32361815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University