View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_high_54 (Length: 240)
Name: NF20469_high_54
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 110 - 224
Target Start/End: Original strand, 10458122 - 10458236
Alignment:
| Q |
110 |
gctttagatagaagtgacagaacgagggttaccaccaaccacgtagaagaagacactattaatgcatttcataaaacgttctaagaagcatacggatata |
209 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10458122 |
gcttgagagagaagtgacagaacgagggttaccaccaaccacgtagaagaagacactattaaagcatttcataaaacgttctaagaagcatacggatata |
10458221 |
T |
 |
| Q |
210 |
tttagcttgaaatat |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10458222 |
tttagcttgaaatat |
10458236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 10458008 - 10458051
Alignment:
| Q |
1 |
ttgatggaaagatcataccctcgatagtttctttttataggcaa |
44 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10458008 |
ttgatggaaagaccataccctcgatagtttctttttataggcaa |
10458051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University