View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_high_60 (Length: 221)
Name: NF20469_high_60
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_high_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 33822613 - 33822429
Alignment:
| Q |
15 |
agcatagggagcagaatgaagaagggtttgaactttggacattttaaaaacttcttttgtatcccttaccaacggaactacctatatggacacgatattg |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
33822613 |
agcatagagagcagaatgaagaagggtttgaactttggacatttttaaaacttcttttgtatcccttaccaactgaactacctatatcgacacgatattg |
33822514 |
T |
 |
| Q |
115 |
tgtgttgaatctttttatttctttgatttagaaatgtttgataatcttgcatttaatttcttgttaaggttgatgccatacacgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33822513 |
tgtgttgaatctttttatttctttgatttagaagtctttgataatcttgcatttaatttcttgttaaggttgatgccatacacgt |
33822429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University