View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_low_27 (Length: 383)
Name: NF20469_low_27
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 373
Target Start/End: Complemental strand, 15097077 - 15096702
Alignment:
| Q |
1 |
tctttttcatgtgccttttaattacttcttggttatagtgacgcaatttggagtacctggcgtggcgatggcgtccgtgttaacgaatatgaacatggtt |
100 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15097077 |
tctttttcatgtgcctttgaattatttcttggttatggtgatgcaatttggtgtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggtc |
15096978 |
T |
 |
| Q |
101 |
gtattgatggcggggtatgtcggcttgtttaggaagaaggagatgatgttaaagtggcccggctg---cggcggtggcggagggatgatggttgtgagtg |
197 |
Q |
| |
|
|| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || || |||||||||||||||||||||||| || |||| |
|
|
| T |
15096977 |
gtgttgatggcggggtatgtcgggttgtttaggaagaaggagatgatgttaaaatggccgggttgtggcggcggtggcggagggatgatggtggttagtg |
15096878 |
T |
 |
| Q |
198 |
aaggtttgggggagttgatgaaattggctgtacctagttgtcttatgatatgtttggaatggtggtggtatgagattgttactgttttggctggttattt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096877 |
aaggtttgggggagttgatgaaattggctgtacctagttgtcttatgatatgtttggaatggtggtggtatgagattgttactgttttggctggttattt |
15096778 |
T |
 |
| Q |
298 |
ggagaatcctacattggctgttgctgctactgggattttgattcagacaactagtatgatgtatactgtccctatg |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096777 |
ggagaatcctacattggctgttgctgctactgggattttgattcagacaactagtatgatgtatactgtccctatg |
15096702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University