View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_low_47 (Length: 281)
Name: NF20469_low_47
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 21 - 265
Target Start/End: Original strand, 38038005 - 38038239
Alignment:
| Q |
21 |
aatcatccaagtccataaaacctccaactcacgcctccacttcaccatccctcaacaccaacccagatctccaaggttcaatttcatttgatttgatttc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38038005 |
aatcatccaagtccataaaacctccaactcacgcctccacttcaccatccctcaacaccaacccagatctccaaggttcaattt----------gatttc |
38038094 |
T |
 |
| Q |
121 |
tagggttttctcacccccaatcactttcatcttttattaatttcatatattttatttttctaatatgatttggttgcggttactacagatgaacacaacg |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038095 |
tagggttttctcacccccaatcaccttcatcttttattaatttcatatattttatttttctaatatgatttggttgcggttactacagatgaacacaacg |
38038194 |
T |
 |
| Q |
221 |
gcagcgaggctgtgcttcgacaatttgacatgaacatgaagtatg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038195 |
gcagcgaggctgtgcttcgacaatttgacatgaacatgaagtatg |
38038239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University