View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_low_48 (Length: 280)
Name: NF20469_low_48
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 25 - 269
Target Start/End: Complemental strand, 37712688 - 37712444
Alignment:
| Q |
25 |
cttctttggtcgtgaagttggtgctgctgataggaagcttttaccgacatacgagttgaaaagccgtacttatcttggtccaacagccatggatgcggag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
37712688 |
cttctttggtcgtgaagttggtgctgctgataggaagcttttaccgacatacgagttgaaaagccgtacttatcttgggccaacagctatggatgcggag |
37712589 |
T |
 |
| Q |
125 |
atagcttttctaatggccaaccaagcactggctactccgggaaaactagtttatgacccttttgttggaaccggaagtattcttgttgcagcagctcatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37712588 |
atagcttttctaatggccaaccaagcactggctactccggggaaactagtttatgacccttttgttggaaccggaagtattcttgttgcagcagctcatt |
37712489 |
T |
 |
| Q |
225 |
ttggagcaatgaccatggtctgcttctccttcttcattcttctct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37712488 |
ttggagcaatgaccatggtctgcttctccttcttcattcttctct |
37712444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University