View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_low_56 (Length: 242)
Name: NF20469_low_56
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_low_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 10818764 - 10818541
Alignment:
| Q |
1 |
tatatattcataaagaatatgcaatgctttcttaaggcaataacctgaaattatcttaagcaaattagcttcactaaaaatcaaataaattgctattgaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10818764 |
tatatatt-ataaagaatatgcaatgctttcttaaggcaataacctgaaattatcttaagcaaattagcttcactaaaaatcaaataaattgctattgaa |
10818666 |
T |
|
| Q |
101 |
tggaaacattgaagg--gagaagagaggtgtatcaaaccttgccatgcatactcagcagcctcagaaagcaaatataaatatttatatatatggtagcga |
198 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10818665 |
tggaaacattgaagggagagaagagaggtgtatcaaaccttgccatgcatgctcagcagcctcaggaagcaaatataaatatttatatatatggtagcga |
10818566 |
T |
|
| Q |
199 |
gagacatgcattgcagagcaaactct |
224 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
10818565 |
gagacatgca-tgcagagcaaactct |
10818541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 38 - 143
Target Start/End: Original strand, 36949184 - 36949297
Alignment:
| Q |
38 |
caataacctgaaattatcttaagcaaattag----cttcactaaaaatcaaataaattgctattgaatggaaacattgaaggga----gaagagaggtgt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||| ||||||||||||| || | ||||||| || |
|
|
| T |
36949184 |
caataacctgaaattatcttaagcaaattagatagcttcacaaaaaatcagataaattgctattgattggaaacattgaaaagacaagggagagaggggt |
36949283 |
T |
|
| Q |
130 |
atcaaaccttgcca |
143 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36949284 |
atcaaaccttgcca |
36949297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University